Home

Description

Search Catalogues

Browse catalogues

Collections

Guidelines

Search Web Site

Contacts

FAQ

Site Map

Mirrors

BCCM/LMBP Plasmid Collection

Address Department of Molecular Biology
Ghent University
'Fiers-Schell-Van Montagu' building
Technologiepark 927
B-9052 Gent-Zwijnaarde
Belgium
Phone +32-9-33.13.843
Fax +32-9-33.13.504
Email bccm.lmbp@dmbr.ugent.be
WWW http://www.dmbr.ugent.be/lmbp/
http://www.belspo.be/bccm/lmbp.htm
Conditions PLEASE TAKE THE FOLLOWING CONDITIONS INTO ACCOUNT:
  • Resources of the public collection are accessible to the scientific community under the conditions of the general BCCM Material Transfer Agreement (MTA), if necessary amended with additional conditions possibly already attached to the biological material.
    They are distributed for a fee covering expenses. See pricelist.
  • The biological resources are made available to all bona fide individuals operating in a professional environment suitable for handling living material of the biohazard group involved.
  • Recipients should verify that they are allowed to receive microbial resources under national and international regulations.
  • To avoid delay in delivery, copies of appropriate certificates or import licenses, specific mailing tags or shipment regulations should accompany the order.
  • First order of your company/laboratory
    First orders should be sent by mail or fax, written on paper with the customer's official letterhead, signed by an authorized person.
    With your first delivery, a customer number will be allocated to your company/laboratory.
  • Further orders
    Further orders can be made via the CABRI on line shopping cart using your customer number.
Contact Person Martine Vanhoucke (Martine.Vanhoucke@dmbr.UGent.be)
Additional Database Information BCCM_LMBP

Example of an entry from the BCCM_LMBP catalogue.
(This example is taken from BCCM/LMBP catalogue submitted to CABRI on March 6,2003)

Collection_number LMBP 3281
Name pLT10T
Other_culture_collection_numbers -
Type Plasmid
Class Recombinant
Literature Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
History_of_deposit This plasmid was deposited by Dr N. Mertens and Prof. E. Remaut (Dept of Molecular Biology, Ghent University, Belgium).
Restricted_distribution LMBP restrictions
PL promoter patent
Host_for_distribution Escherichia coli K12 MC1061(lambda)
Medium LB
Selectable_phenotype Ampicillin (amp)
Replicon Escherichia coli plasmid pMB1 origin
Host_range Any Escherichia coli with a cI function
For PL driven expression use a strain with a cIts function (cI857).
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function: preferably a pT7POL plasmid (Mertens et al., Bio/Technology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857].
In both cases, proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid.
Properties_and_applications Expression vector: general expression
Cloned_gene -
Promoter Phage lambda major leftward promoter (lambda PL)
Phage T7 gene 10 promoter (T7g10)
Ribosome_binding_site Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10)
Terminator Phage T7 gene 10 terminator (T7g10)
Further_information Start of the nucleotide sequence in the middle of the non-unique EcoRI site between the PL and the T7 promoter.
The construction of this plasmid is described in Mertens et al., Gene 164 (1995), 9-15.
pLT10T was designed for bacterial expression of heterologous genes after an ApaI digestion and blunting the 3' sticky ends, making the ATG start codon on the plasmid accessible for blunt-end ligation to fragments encoding the mature coding sequence. Ligation to other sites will result in the production of a fusion protein.
BamHI, BstXI, HindIII, MluI and SacI cannot be used for expression, since the HindIII site contains a termination codon in phase with the ATG codon.
Other name of the plasmid is pPLT10T.
The EcoRI and XbaI expression sites are not unique (use 3-fragment ligation).
The lambda PL promoter is covered by the following patents issued to Biogen, Inc, Cambridge, MA, USA: U.S. Patent No. 4,874,702; Canadian Patent No. 1,207,251; European Patent No. 41,767.
Restriction_sites E-AatII, E-ApaI, E-AsuI, E-BseRI, E-ClaI, E-EcoRI, E-KpnI, E-SmaI,
E-SphI, E-XbaI, E-XhoI
U-AatII, U-AccI, U-AlwNI, U-ApaBI, U-ApaI, U-AsuII, U-BamHI,
U-BcefI, U-BcgI, U-BciVI, U-BglI, U-BplI, U-Bpu10I, U-BsaAI,
U-BsaXI, U-BseRI, U-BsmI, U-BspLU11I, U-BsrBI, U-BstXI, U-ClaI,
U-DraII, U-DraIII, U-Eam1105I, U-EcoNI, U-Esp3I, U-GsuI, U-HindIII,
U-KpnI, U-MluI, U-MstI, U-NaeI, U-Pfl1108I, U-PstI, U-PvuI,
U-PvuII, U-SacI, U-SapI, U-ScaI, U-SgrAI, U-SmaI, U-SnaI,
U-SphI, U-SspI, U-StuI, U-StyI, U-Tth111I, U-XhoI, U-XmnI
Sequence_detail 
Nucleotide sequence around the Shine-Dalgarno (SD) position of
the T7 gene 10 ribosome binding site:
 
                     |
 5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
    ---------------->|                     XbaI
      T7 promoter
 
                       *
    TAAGAAGGAGATATACAT ATG.GGC.CCG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG.
        ------           ApaI    AatII   SphI        XbaI    XhoI
          SD
 
    AGG.AAT.TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA.GCT.TGG.ATC.CGG.
      EcoRI   KpnI   SmaI            ClaI    HindIII BamHI
                                            @
 
    AGA.GCT.CCC.AAC.GCG.TTG 3'
     SacI        MluI
 
 
 *: Start codon.
 @: Termination codon.
 Punctuation indicates reading frame.
 
 How to make the ATG start codon accessible for blunt-end ligation:
       
 5' ATG.GGC.C|CG 3'
 3' TAC|CCG.G GC 5'
      ApaI
 
        |
        | ApaI digestion
        |
 
 5' ATG.GGC.C 3'
 3' TAC       5'
 
        |
        | T4 DNA polymerase
        |
 
 5' ATG 3'
 3' TAC 5'
 
 
 |: Cleavage site of ApaI.
 Punctuation indicates reading frame.

Top of Page

© The CABRI Consortium 1999-2003. This work cannot be reproduced in whole or in part without the express written permission of the CABRI consortium.

Home    Description    Search Catalogues    Browse catalogues    Collections    Quality Guidelines

Search Web Site    Contacts    FAQ    Site Map    Mirrors

Site maintained by the CABRI webmaster. Last revised on December 5, 2003.