Home
Description
Search Catalogues
Browse catalogues
Collections
Prices
Guidelines
Contacts
FAQ
Site Map
Last revised: January 2020
|
BCCM/GeneCorner Plasmid Collection
|
Address
|
Department of Biomedical Molecular Biology
Ghent University
Technologiepark-Zwijnaarde 927
B-9052 Gent
Belgium
|
|
Phone
|
+32-9-33.13.843
|
|
Email
|
bccm.genecorner@ugent.be
|
|
WWW
|
http://www.irc.ugent.be/genecorner/
http://bccm.belspo.be/about-us/bccm-genecorner
|
|
Conditions
|
PLEASE TAKE THE FOLLOWING CONDITIONS INTO ACCOUNT:
- Resources of the public collection are accessible to the scientific community under the conditions of the general
BCCM Material Transfer Agreement (MTA),
if necessary amended with additional conditions possibly already attached to the biological material.
They are distributed for a fee covering expenses. See pricelist.
- The biological resources are made available to all bona fide individuals operating in a professional environment suitable for
handling living material of the biohazard group involved.
- Recipients should verify that they are allowed to receive microbial resources under national and international regulations.
- To avoid delay in delivery, copies of appropriate certificates or import licenses, specific mailing tags or shipment regulations
should accompany the order.
- First order of your company/laboratory
First orders should be in writing, preferably by e-mail using your institute's e-mail account
With your first delivery, a customer number will be allocated to your company/laboratory.
- Further orders
Further orders can be made via the CABRI on line shopping cart using your customer number.
|
|
Contact Person
|
Martine Vanhoucke (Martine.Vanhoucke@ugent.be)
|
|
Additional Database Information
|
BCCM_LMBP
|
Example of an entry from the BCCM_LMBP catalogue.
(This example is taken from BCCM/GeneCorner catalogue submitted to CABRI on June 20,2016)
| Collection_number |
LMBP 3281 |
| Name |
pLT10T |
| Other_culture_collection_numbers |
- |
| Type |
Plasmid |
| Class |
Recombinant |
| Literature |
Mertens et al., Gene 164 (1995), 9-15 [PMID: 7590329]
|
| History_of_deposit |
This plasmid was deposited by Dr N. Mertens and Prof. E. Remaut (Dept of Molecular Biology, Ghent University, Belgium). |
| Restricted_distribution |
LMBP restrictions PL promoter patent |
| Host_for_distribution |
Escherichia coli K12 MC1061(lambda) |
| Medium |
LB |
| Selectable_phenotype |
Ampicillin (amp) |
| Replicon |
Escherichia coli plasmid pMB1 origin |
| Host_range |
Any Escherichia coli with a cI function
For PL driven expression use a strain with a cIts function (cI857).
For T7 driven expression use a strain containing a controllable T7 RNA polymerase gene, as well as a cI function:
preferably a pT7POL plasmid (Mertens et al., Bio/Technology 13 (1995), 175-179) or e.g. BL21(DE3)[pcI857].
In both cases, proceed as follows: first transform auxiliary plasmid, make competent cells again and then transform the expression plasmid. |
| Properties_and_applications |
Expression vector: general expression |
| Cloned_gene |
- |
| Promoter |
Phage lambda major leftward promoter (lambda PL) Phage T7 gene 10 promoter (T7g10) |
| Ribosome_binding_site |
Ribosome binding site (RBS) of the phage T7 gene 10 (T7g10) |
| Terminator |
Phage T7 gene 10 terminator (T7g10) |
| Further_information |
Start of the nucleotide sequence in the middle of the non-unique EcoRI site between the PL and the T7 promoter.
The construction of this plasmid is described in Mertens et al., Gene 164 (1995), 9-15.
pLT10T was designed for bacterial expression of heterologous genes after an ApaI digestion and blunting the 3' sticky ends, making the
ATG start codon on the plasmid accessible for blunt-end ligation to fragments encoding the mature coding sequence.
Ligation to other sites will result in the production of a fusion protein.
BamHI, BstXI, HindIII, MluI and SacI cannot be used for expression, since the HindIII site contains a termination codon in phase with
the ATG codon. Other name of the plasmid is pPLT10T.
The EcoRI and XbaI expression sites are not unique (use 3-fragment ligation).
The lambda PL promoter is covered by the following patents issued to Biogen, Inc, Cambridge, MA, USA: U.S. Patent No. 4,874,702;
Canadian Patent No. 1,207,251; European Patent No. 41,767. |
| Restriction_sites |
E-AatII, E-ApaI, E-AsuI, E-BseRI, E-ClaI, E-EcoRI, E-KpnI, E-SmaI,
E-SphI, E-XbaI, E-XhoI
U-AatII, U-AccI, U-AlwNI, U-ApaBI, U-ApaI, U-AsuII, U-BamHI,
U-BcefI, U-BcgI, U-BciVI, U-BglI, U-BplI, U-Bpu10I, U-BsaAI,
U-BsaXI, U-BseRI, U-BsmI, U-BspLU11I, U-BsrBI, U-BstXI, U-ClaI,
U-DraII, U-DraIII, U-Eam1105I, U-EcoNI, U-Esp3I, U-GsuI, U-HindIII,
U-KpnI, U-MluI, U-MstI, U-NaeI, U-Pfl1108I, U-PstI, U-PvuI,
U-PvuII, U-SacI, U-SapI, U-ScaI, U-SgrAI, U-SmaI, U-SnaI,
U-SphI, U-SspI, U-StuI, U-StyI, U-Tth111I, U-XhoI, U-XmnI |
| Sequence_detail |
Nucleotide sequence around the Shine-Dalgarno (SD) position of
the T7 gene 10 ribosome binding site:
|
5' TAATACGACTCACTATA|GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
---------------->| XbaI
T7 promoter
*
TAAGAAGGAGATATACAT ATG.GGC.CCG.ACG.TCG.CAT.GCT.CCT.CTA.GAC.TCG.
------ ApaI AatII SphI XbaI XhoI
SD
AGG.AAT.TCG.GTA.CCC.CGG.GTT.CGA.AAT.CGA.TAA.GCT.TGG.ATC.CGG.
EcoRI KpnI SmaI ClaI HindIII BamHI
@
AGA.GCT.CCC.AAC.GCG.TTG 3'
SacI MluI
*: Start codon.
@: Termination codon.
Punctuation indicates reading frame.
How to make the ATG start codon accessible for blunt-end ligation:
5' ATG.GGC.C|CG 3'
3' TAC|CCG.G GC 5'
ApaI
|
| ApaI digestion
|
5' ATG.GGC.C 3'
3' TAC 5'
|
| T4 DNA polymerase
|
5' ATG 3'
3' TAC 5'
|: Cleavage site of ApaI.
Punctuation indicates reading frame.
|
Top of Page
© The CABRI Consortium 1999-2020.
This work cannot be reproduced in whole or in part without the express written permission of the CABRI consortium.
Site maintained by Paolo Romano.
Last revised in January 2020.
|